CHAPTER 8 MICROBIAL GENETICS
Genetics
is the science of heredity. It includes:
·
What are genes
·
How do they carry
information
·
How are they replicated
(copied)
·
How are they passed to
subsequent generations of cells
·
How are they passed from organism
to organism
·
How does their expression
determine the characteristics of the organism
A gene is a segment of DNA that codes for a functional product.
Genome—alll the genes of an organism
Chromosomes are DNA molecules that contain the genes. A DNA
molecule consists of linked nucleotides. Each nucleotide consists of:
·
Pentose (5-carbon) sugar
called deoxyribose
·
Phosphate group
·
Nitrogenous base
Adenine- - - - - - -Thymine
Cytosine- -
- - - - - Guanine
A DNA molecule is described as a double helix.
Double---this means
that there are two strands of linked nucleotides. The structure can be compared
to a ladder—the sugars and phosphates form the two uprights of the ladder and
the nitrogenous bases meet in the middle to form the rungs. The bases are held
together by hydrogen bonds. The bases can pair up only as shown above, forming
base pairs, and
when the two strands are properly matched they are said to be complementary.
Helix—the ladder
twists tightly into a spiral
The sequence (order) of the bases in a gene gives the formula
for the amino acids which must be linked to form the protein for which the gene
codes. A gene is used as a template (pattern) for making messenger RNA (mRNA),
which goes to a ribosome and is used to make a protein. A few genes give
instructions for making ribosomal RNA (rRNA) or transfer RNA (tRNA) instead of
a protein. When the molecule the gene codes for has been made, we say that the
gene has been expressed.
While a gene is being used as a pattern, the two strands of DNA
must be separated. The hydrogen bonds that link the strands are weak and easily
broken.
The two strands of DNA must also separate when the DNA is
replicated prior to cell division.
DNA can change (mutate). This is often damaging or fatal to the
cell, but some mutations are favorable, creating new characteristics that give
an advantage for survival.
GENOTYPE AND
PHENOTYPE
Genotype—the entire genetic makeup of the organism--all of its
DNA. Not every gene is expressed all
of the time, but the potential is there.
If a change in genotype occurs, it is considered permanent.
Phenotype—expressed properties. In macroscopic organisms, this
often refers to appearance. In microbes, on a molecular level, this could refer
to the collection of proteins the organism is currently making. This influences
all activities of the cell, since the enzymes which catalyze all the cell’s
chemical reactions are proteins.
In microbes, changes in phenotype are common and can go back
and forth with varying conditions.
DNA AND
CHROMOSOMES
Bacteria have a single circular chromosome, which is a single
molecule of DNA with associated proteins. The DNA is twisted, looped, and
folded by an enzyme called DNA gyrase. Escherichia coli has
about 4.6 million base pairs in its chromosome, which would be about 1 mm long
if it were untwisted. Since the chromosome is tightly twisted into a helix, it
takes up only about 10 % of the cell's volume. The complete base sequence of the chromosomes of several species of bacteria have
been determined in recent years.
Genomics is the science of sequencing and molecular characterization of
a genome.
Remember, eukaryotic organisms have linear chromosomes in
varying numbers, but always more than one. Another major difference:
·
All the DNA of the
bacterial chromosome is "good" DNA, which gives instructions for
making proteins needed by the cell
·
In eukaryotic chromosomes,
a large part of the DNA is "junk" DNA, which does not code for
proteins or appear to have any other useful purpose either. This
"junk" DNA is known as introns. The "good" DNA is known as
exons. Introns and exons are mixed together along the chromosomes of
eukaryocytes.
DNA
REPLICATION
Before any type of cell division, the DNA must be copied
(replicated) so that a complete set can be passed on to the daughter cells.
This is true whether it is a eukaryotic cell dividing by mitosis or a
prokaryotic cell dividing by binary fission. The plan is that the two
original strands (parent strands) of DNA
will unwind and separate, and a new complementary strand to each of them will
be synthesized by matching free nucleotides in the cytoplasm up to each parent strand.
In bacteria, only a small area of the original chromosome, known as the
replication fork, will be opened up and separated at once, but eventually the
entire chromosome will be replicated. The process is catalyzed by the enzyme
DNA polymerase. Since each copy of the chromosome will now contain one original
parent strand and one newly synthesized strand, the process is called
semiconservative replication.
This is a complicated process. First, we must take another look
at the structure of the two complementary strands of DNA. The sugars of one
strand are upside down compared to the sugars of the other strand. Each carbon
in a sugar molecule is numbered, 1 --
5. This is the structure of one sugar molecule:
This is the way the sugars (and other components) are arranged
in a complementary section of DNA:
DNA polymerase can add new nucleotides only to the 3'
end, or in the 5' à 3' direction.
Steps in replication:
1. Enzyme unwinds the
double strand and proteins stabilize the unwound DNA.
2. A replication fork forms at a fixed site called the origin
of replication. (This is where the complementary strands begin to separate)
3. Beginning with a small length of RNA called an RNA primer, a
new DNA strand complementary to each of the separated strands is synthesized,
one nucleotide at a time.
4. DNA polymerase removes the RNA primers and replaces them
with DNA.
In some bacteria, two
replication forks form and move in opposite directions around the chromosome
until they meet.
DNA polymerase evaluates the new strand as it forms, checking
that each new base is really complementary to the base of the parent strand. If
an incorrect base sneaks in, the enzyme will snip it out and replace it. This
is to ensure that very few mistakes are made in the copying process.
RNA AND
PROTEIN SYNTHESIS
In some ways, RNA and DNA are alike. Both have nucleotides as
their building blocks, and both are concerned with producing proteins. Here are
some ways that RNA differs from DNA:
·
RNA is always a single
strand
·
RNA nucleotides have a
slightly different sugar, ribose instead of deoxyribose (it is still a pentose)
·
Nitrogenous bases---3 are
the same but there is also one difference---RNA has no thymine, but has uracil
instead
·
RNA comes in 3 kinds:
1. Messenger RNA (mRNA)---this
is synthesized using DNA as a template (pattern). One strand of mRNA most often
contains the instructions from one gene for making one protein. It carries this
information to a ribosome. In a eukaryotic cell, this occurs in the nucleus.
Remember, our prokaryotic bacteria do not have a separate nucleus, so it occurs
in the nuclear area.
2. Ribosomal RNA (rRNA)---this
type makes up the ribosomes, along with ribosomal proteins, which mostly are
enzymes. The rRNA reads the mRNA to determine the sequence (order) of amino
acids to be put into the protein. The ribosomal enzymes build the peptide bonds
that hold the protein together.
3. Transfer RNA (tRNA)---binds
to a specific amino acid (which it finds in the cytoplasm) and brings it to the
ribosome.
To begin
the process of protein synthesis, genetic information in DNA is used as a
pattern to make a complementary strand of messenger RNA. This part of the
process is called transcription. The mRNA carries the instructions for making
the protein to a ribosome, where amino acids will be linked together in the
second step of the process, translation.
TRANSCRIPTION
This is
the synthesis of a strand of mRNA complementary to the gene on the DNA. The
instructions for making the specific protein are coded into the mRNA by the
sequence of the bases. As the mRNA is made, here is the way bases match up
between DNA and RNA:
DNA bases RNA bases
Thymine- - - - - - - Adenine
Cytosine- - - - - - -Guanine
Guanine- - - - - - - -Cytosine
Adenine- - - - - - - -Uracil (no tymine
in RNA)
For
transcription to occur, a supply of RNA nucleotides must available in the cell
and the enzyme RNA polymerase is required to catalyze the reactions. Since
procaryocytes have no separate nucleus, the process occurs in the cytoplasm.
(It occurs in the nucleus of a eucaryotic cell.) Steps in transcription:
1. Gene for a needed protein is located.
2. The helix unwinds and the two strands of
DNA separate, just in the area of the gene.
3. RNA polymerase binds to the strand of DNA
that contains the gene at a site called the promoter. RNA also must be
synthesized in the 5' à 3' direction, but this is not a problem because the promoter
will always be found at the location that makes this possible.
4. RNA polymerase links together nucleotides
from the cytoplasm to form a strand of mRNA complementary to the gene on the
DNA. (The enzyme takes separate available nucleotides and links them together.
The complementary strand of RNA does not exist until these nucleotides are
linked together one by one.)
5. RNA polymerase moves along the DNA,
continuing to form the complementary strand of mRNA, until it reaches a site on
the DNA known as the terminator.
6. At this point, both RNA polymerase and
the mRNA strand are released from the DNA.
7. More than one copy of mRNA may be made if
needed.
8. When mRNA synthesis is complete, the two
strands of DNA reattach and the helix rewinds.
9. Completed mRNA strand(s) go to ribosomes.
GENETIC CODE
The
genetic code allows the ribosome to read the mRNA and, by determining the sequence
of bases, determine the proper amino acids to be linked to form the protein.
Each group of three bases forms a codon. Since there are 4 nitrogenous bases
and a codon may have 3 different bases, 2 same and one different, or 3 of the
same base, the number of possible codons is 64. Only
20 different amino acids are used in making proteins, so in many cases there
will be more than one codon that stands for a particular amino acid. This is
referred to as the degeneracy of the code.
61 of the codons code
for amino acids, and are called sense codons. The remaining 3 codons do not
code for any amino acid, and are known as nonsense, stop, or termination
codons.
AUG is a special sense codon. It stands
for the amino acid methionine, but it is also known as the START codon, since
it is found as the first codon on all mRNA. As proteins are assembled, all have methionine as
their first amino acid, but often this methionine is later removed.
UAA
UAG These are the STOP codons, also
called nonsense or termination codons
UGA
TRANSLATION
This step
in protein synthesis occurs at a ribosome. Amino acids are linked by peptide
bonds (a special form of covalent bonds). Steps:
1. A ribosome binds to the strand of mRNA at
the START codon (AUG).
2. tRNA will bring
the amino acids to the ribosome. A tRNA molecule looks like this:
3. Each tRNA can bind to only one amino acid.
The anticodon of a tRNA will be complementary to a codon on mRNA, and that mRNA
codon calls for a specific amino acid. That will be the only amino acid that
can bind to a tRNA with that anticodon.
4. tRNA brings the
first amino acid, methionine, to the ribosome. The anticodon of the tRNA will
be complementary to AUG, so the codon and anticodon will temporarily bind
together.
AUGCUGCCUUAUUACAGAGGGCAUUAA
5. A second tRNA, with an anticodon
complementary to the second codon (CUG) brings the second amino acid to the
ribosome and binds temporarily to the complementary codon on mRNA.
6. The first two amino acids are joined by a
peptide bond (enzymes associated with the ribosome form this), and the first
tRNA is released.
7. The third amino acid is brought by tRNA
and a peptide bond is formed between amino acid #2 and amino acid #3.
8. The second tRNA is released.
9. This continues, forming a polypeptide
chain, until a STOP codon is reached.
10. The ribosome detaches from the mRNA and
the polypeptide chain (which is usually a complete protein) is released. The
ribosome and the mRNA can be used again.
In the
process of translation, the ribosome moves along the strand of mRNA as the
polypeptide chain forms. As soon as the ribosome has moved along far enough to
leave the START codon exposed, a second ribosome can bind and begin another
polypeptide chain.
These
steps are quite similar in eukaryotic cells, but there are also some differences.
Transcription occurs inside the nucleus. The completed mRNA then leaves the
nucleus and goes to ribosomes for translation. But in eukaryotic cells an
additional step is required, since the good information of the genes (exons) is
all mixed up with the genetic "junk" (introns). After the mRNA is completed, with both
introns and exons included, special enzymes snip out the introns and splice the
exons together. Only then does the mRNA leave the nucleus.
REGULATION OF BACTERIAL GENE
EXPRESSION
Cells
must regulate the synthesis of proteins, making only those proteins that are
needed at any particular time. Many of these proteins are enzymes, which
catalyze the chemical reactions that occur within the cell. By regulating the
activity of the genes that code for these enzymes, all of the chemical activity
of the cell can be regulated.
Many of the bacterial proteins are always
needed, so the genes for these proteins are not regulated. These are known as
constitutive genes, and their products are constantly produced, so these genes
could be said to be turned on at all times. An example of enzymes that would be
classified this way are the enzymes needed for
glycolysis.
Other
genes must be regulated, since their proteins are not needed at all times. This
is done in two main ways, both of which control the amount of the enzyme
present but do not influence the activity of the enzyme.
1. Repression---this is a regulatory
mechanism that inhibits gene expression and therefore decreases the synthesis
of enzymes. When the end-product of a metabolic pathway begins to accumulate in
excess amounts in the cell, repression slows or stops the synthesis of enzymes
in the pathway. Regulatory proteins called repressors are produced, and these
block the ability of RNA polymerase to transcribe the repressed genes.
2. Induction---this is a process that turns
on the transcription of a gene or genes. A substance that acts to cause
transcription of a gene is called an inducer. Enzymes that are synthesized only
in the presence of an inducer are known as inducible enzymes. This might be
illustrated by an example:
Escherichia
coli has the ability to produce an inducible
enzyme that breaks down lactose. If it is in a medium which does not contain
lactose, there is no need for this enzyme and the cell does not produce it
since the inducer is not present. If lactose is added to the medium, it acts as
an inducer for the enzyme, so the cell begins to produce the enzyme and the
lactose can be used.
OPERON MODEL OF GENE EXPRESSION
This is
a description of the details of the control of gene expression by induction and
repression. Induction of the enzymes involved in lactose catabolism in Escherichia coli can
be used as the example.
Three
enzymes are needed for taking in and breaking down lactose. The genes for these
enzymes are located next to each other on the bacterial chromosome. If one of
the enzymes is needed, all of them are. If no lactose is present, none of the
enzymes are needed, so the
enzymes are regulated together. These genes, which determine the
structures of proteins, are known as structural genes.
Associated
with the three structural genes are two segments of DNA which make up the
control region. One segment is the
promoter, which is the region of DNA where RNA polymerase initiates
transcription. The other is the operator, which can be described as a traffic
light, acting as a stop or go signal for the transcription of the structural
genes. The entire group of structural genes plus the 2 segments of the control
region are known as the lac operon.
Near the
lac operon is a regulatory gene
called the I
gene, which codes for a repressor protein. When there is no lactose present,
the repressor protein binds tightly to the operator site and this binding
prevents RNA polymerase from transcribing the lac operon genes. Under these conditions, no mRNA is made and none
of the three enzymes can be synthesized.
When
lactose is present, a small amount of it enters the cell and is converted to
allolactose. Allolactose acts as an inducer. It binds to the repressor protein
and alters it so that it cannot bind to the operator site. RNA polymerase can
now transcribe the structural genes into mRNA, and the enzymes are made. Lactose
is said to induce enzyme synthesis, and the lac
operon is called an inducible operon.
Repressible
operons work almost the same, but this time the structural genes are constantly
transcribed unless they are turned off (repressed). Genes for the enzymes involved
in the synthesis of the amino acid tryptophan are regulated this way.
1. As
long as tryptophan is needed, the genes are constantly transcribed and the
enzymes are made.
2. A
repressor protein is present but inactive. In this form it cannot bind to the
operator and stop transcription.
3. When
excess tryptophan accumulates, it combines with the inactive repressor protein.
The tryptophan is acting as a corepressor.
4. The
combination (tryptophan plus the repressor protein) binds to the operator and
stop transcription of the structural genes.
MUTATION: CHANGE IN THE GENETIC MATERIAL
A
mutation is a change in the base sequence of DNA. This will sometimes cause a
change in the product encoded by that gene. If the gene is an enzyme, the enzyme
may become more or less active because of a change in the amino acid sequence.
If the mutation makes the enzyme less active, this will be harmful or lethal to
the cell. If the mutation makes the enzyme more active, this may benefit the
cell.
TYPES OF MUTATIONS
1. Base
substitutions (point mutations) cause the change of one single base in the DNA.
These include three categories and three possible effects:
a. Missense mutation---the change in the DNA
results in mRNA that codes for an incorrect amino acid
in the protein that the gene gives instruction for. Even one incorrect amino
acid can have a serious effect on the finished protein. An example of this is
the one incorrect amino acid in two of the polypeptide chains of the hemoglobin
of individuals with sickle-cell disease. This results in hemoglobin that forms
crystals in the cytoplasm of the red blood cells, deforming them and making
them likely to block small capillaries.
b. Nonsense mutation---the change creates a
stop (nonsense) codon in the middle of the mRNA molecule, causing the
termination of the protein before it is finished. Since only a fragment of the
protein is synthesized, the result is nonfunctional.
c. Neutral (silent) mutation---the base
sequence changes, but by chance the new codon still calls for the same amino
acid as the original. This results in no change in the finished protein.
2.
Frameshift mutations---in this type of mutation, one or several bases are
inserted or deleted in the DNA. This can completely shift the “translational
reading frame” of the codons. This almost always results in a long string of
incorrect amino acids from the point of the insertion or deletion. Often a stop
codon will result and cause termination of the protein before the normal end.
The typical result is a nonfunctional protein.
3.
Rarely, mutations occur that involve insertion of large numbers of bases into a
gene. How this type of mutation occurs is not understood. Huntington's disease
is an example
Spontaneous
mutations of all these types occur by chance because of mistakes made during
DNA replication. The same types of mutations may also be the result of exposure
to mutagens, chemicals or radiation which cause
mutations.
Among
bacteria, mutations may make the organisms resistant to antibiotics or cause
them to become more or less virulent (able to cause disease). A strain of Salmonella typhimurium has altered its outer membrane so that it
can be phagocytized but not killed by a macrophage. If a mutation causes an organism to lose its
capsule or to have a thinner capsule than normal, the organism may become less
pathogenic or nonpathogenic (Streptococcus
pneumoniae, Hemophilus influenzae, Neisseria meningitidis).
MUTAGENS
CHEMICAL MUTAGENS
1. Nitrous acid---at random locations, this
chemical reacts with adenine and changes it to a form that pairs with cytosine
instead of thymine.
2. Nucleoside (base) analogs---molecules
that are structurally similar to the normal nitrogenous bases but do not pair
with the normal complementary base. Chemicals such as this are used in some
antiviral and antitumor drugs.
3. Some chemical mutagens cause small
deletions or insertions, so that frameshift mutations occur. Benzpyrene in
smoke and soot and aflatoxin, sometimes present in moldy peanuts, act this way.
Acridine dyes, present in Agent Orange and currently used in some antiviral
drugs are other examples.
Frameshift
mutagens tend to cause cancer.
RADIATION
1. X rays and gamma rays ionize atoms and
molecules. This can be fatal to cells, but in lesser doses these forms of
radiation act as mutagens. As ions are formed, they can combine with bases in
DNA, causing errors in DNA replication and repair. In some cases, chromosomes
may even break apart.
2. Ultraviolet light acts in a different
way. Exposure may result in the formation of thymine dimers, which can cause
serious damage to DNA. DNA affected this way cannot be transcribed or
replicated. If not repaired, this type of damage leads to most cases of skin
cancer.
Damage
of this type can sometimes be repaired by enzymes. Light-repair enzymes use
visible light energy to separate the thymine dimers back to the original form.
Excision repair cuts out the damaged section of DNA and fills the gap with a
new section of DNA complementary to the other undamaged strand. This process
can sometimes also repair damage due to causes other than UV light.
FREQUENCY OF MUTATION
The rate
of spontaneous mutations is usually about one in a million replicated genes.
These mutations occur at random along a chromosome. Among bacteria, harmful
mutations usually result in death or impaired growth, and mutants die out.
Beneficial mutations may make the cells carrying the mutated genes more likely
than others to survive and reproduce, so the number of cells carrying the new
genes soon represents a large percentage of the population. Antibiotic
resistance is an example.
A
mutagen usually increases the rate of mutation by 10 - 1000 times. Many
mutagens are also carcinogens, substances known to cause cancer in animals.
IDENTIFYING MUTANTS
Mutants
can be detected by selecting or testing for altered phenotype. Even when a
mutagen is involved, the number of mutants represents only a very small
percentage of the population.
1. Positive (direct) selection---cells are
placed in surroundings where only mutants can grow. For example, if the
mutation is resistance to penicillin, the bacteria can be placed in a growth
medium containing penicillin, and only mutants can grow.
2. Negative (indirect) selection---this is
looking for a cell that has LOST the ability to perform a certain function due
to a mutation. The technique used is called replica plating.
A mutant
that now requires a specific growth factor that previously could be synthesized
is called an auxotroph.
IDENTIFYING CHEMICAL CARCINOGENS
Carcinogens are mutagens that cause cancer. One way of
identifying these is the Ames test. The chemical being tested is added to
medium containing mutant bacteria. If the chemical is mutagenic, it will cause
more than a random number of mutants to revert to their original form
(back-mutations or reversions). The more of these, the more
powerful the mutagen. About 90% of the chemicals that are positive on
this test will be carcinogens.
GENETIC TRANSFER AND RECOMBINATION
Genetic
recombination refers to the exchange of genes between two DNA molecules to form
new combinations of genes on a chromosome. Genetic recombination regularly
occurs as a part of sexual reproduction. It contributes to genetic diversity of
a population.
Vertical
gene transfer--genes are passed from an organism to its offspring--in humans,
that would mean from parent to child--this also occurs in bacteria
Horizontal
gene transfer--genes are passed between two organisms in the same
generation--bacteria can do this in addition to vertical gene transfer (most
other living things can't)
Although
bacteria do not undergo sexual reproduction, genetic recombination may occur in
several ways. In all mechanisms, the transfer of genetic material involves a
donor cell that gives DNA to a recipient cell. No matter how the DNA enters the
recipient cell, this what occurs:
The
recipient cell is now called a recombinant cell.
WAYS DNA IS TRANSFERRED IN BACTERIA
1. Transformation ---genes are transferred from
one bacterium to another as “naked” DNA in a solution. This process was
demonstrated before it was understood, about 70 years ago, with 2 strains of Streptococcus pneumoniae. One strain,
which did not have a capsule, was avirulent (did not cause disease). The other
strain did have a capsule and caused severe pneumonia. Working on a vaccine
against the virulent strain, Frederick Griffith injected mice with both live
and dead avirulent bacteria, neither of which made the mice sick. However, when
Further
research proved that injecting the mixture of bacteria into mice was not
required. Dead encapsulated bacteria were added to broth containing living non-encapsulated
bacteria. After an incubation period, the culture was found to contain living
encapsulated bacteria.
Experiments
over about 15 years finally proved that the factor being transferred was DNA,
and this was one of the proofs that DNA was indeed the hereditary material of
cells.
It is
now known that some bacteria release DNA into their environment (probably after
cell lysis). In certain cases, other bacteria may encounter this DNA and take
up bits of it, integrating it into their own chromosomes by recombination.
Descendants of the recombinant cell will continue to contain the new genes.
Only
certain bacteria undergo transformation as a natural process. It works best
when the donor and recipient are closely related. A recipient cell that is
receptive to taking in donated DNA is said to be competent. Competent cells
result from alterations in the cell wall that make it
permeable to large DNA molecules. Bacteria which undergo transformation
naturally include the genera Bacillus,
Haemophilus, Neisseria, Acinetobacter, and certain strains of Streptococcus and Staphylococcus. Other bacteria can be treated in the lab to make
them competent.
2. Conjugation---this is another method for
transferring DNA from one bacterium to another. Conjugation requires a special
plasmid (a plasmid is a circular piece of DNA which some bacteria contain in
addition to the bacterial chromosome). The genes carried by plasmids may
influence the characteristics of the cell, but usually are not necessary for
growth of the cell under normal conditions.
Conjugation requires cell-to-cell contact. The conjugating
cells must be of opposite mating types. Donor cells carry the plasmid and
recipient cells do not. In gram-negative bacteria, the plasmid carries genes
that code for the synthesis of sex pili, which are projections from the donor
cell’s surface that attach to the recipient and help bring the two cells
together. Gram-positive cells produce sticky surface molecules that stick the conjugating
cells together.
Our
example is conjugation between 2 Escherichia
coli bacteria, since this is the most studied. Donor cells carry a special
plasmid called the F factor (fertility factor) and are known as F+ cells. Here
are the events when an F+ cell encounters an F- cell (which does not have the F
plasmid).
a. An F+ cell
uses its sex pilus to draw an F- cell to it.
b. One copy of the replicated plasmid
moves across the sex pilus into the F- cell, making it F+.
c. Over time, all the cells in a culture
will become F+.
d. Chromosomal
DNA is rarely transferred this way, usually it is only plasmid DNA.
Sometimes
the F plasmid integrates into the bacterial chromosome, forming a cell type
known as an Hfr (high frequency of recombination) cell.
a. Chromosome and integrated plasmid replicate
and one copy moves toward the F- (recipient) cell. The plasmid will be at the
tail end of the chromosome, and usually the process is disrupted before the
entire chromosome and then the plasmid makes it into the recipient cell. The
part of the chromosome that transfers will integrate into the F- cell’s
chromosome. The plasmid is hardly ever transferred, so the F- cell becomes a
recombinant cell but almost always remains F-.
3. Transduction—this is the third mechanism for
transferring DNA from a donor cell to a recipient cell. A phage (bacteriophage)
is required. When the virus invades a bacterial cell, one of the first steps is
breaking up of the bacterial chromosome. Sometimes random bits of the bacterial
DNA get included inside the protein coats of the new virions the bacterial cell
is making. When these new virions invade new bacterial cells, they take the
bacterial DNA in with them. The virus particles do not have their nucleic acid,
so they do not harm the newly invaded bacterial cells. As the bacterial DNA is
released inside the recipient cell, the new genes integrate into the chromosome
of the new cell. This is generalized transduction.
Specialized
transduction involves the transfer of only certain bacterial genes. The genes
may code for a toxin which the bacteria otherwise would not produce, such as
the diphtheria toxin in Corynebacterium
diphtheriae, erythrogenic toxin in strains of Streptococcus pyogenes causing scarlet fever, and the toxin of Escherichia coli O157:H7.
PLASMIDS
Plasmids
are small circular pieces of DNA found in some bacteria (but not all) and
occasionally in eucaryocytes such as yeasts. They carry genes which are not
found on the bacterial chromosome. Usually the cell can survive and grow
without these genes, but under certain conditions the plasmid genes may be
essential.
1. Conjugative plasmids--the F factor is an
example
2. Dissimilation plasmids---code for enzymes
that allow the cell to break down and use for nutrients unusual sugars and
hydrocarbons. Pseudomonas is an
example--it has been found growing in solutions of some chemical disinfectants.
Some of these plasmids make the bacteria that carry them able to break down
toxic material in the environment, oil spills, etc.
3. Plasmids that code for toxins which
increase the virulence of bacteria that carry them.
This includes a toxin of Staphylococcus
aureus, Clostridium tetani neurotoxin, Escherichia
coli enterotoxin, and the toxins of Bacillus
anthracis.
4. Some plasmids code for bacteriocins,
toxic proteins which kill other bacteria that do not also carry the plasmid.
5. R (resistance factor) plasmids—these
code for resistance factors and are currently very important in medicine. These
plasmids give bacteria resistance to antibiotics, heavy metals, or cellular
toxins. Since they can be transferred from one bacterium to another, bacteria
which have never been exposed to a certain antibiotic can already have
developed resistance to it. One plasmid can carry genes for resistance to a
number of antibiotics. Widespread use of antibiotics in medicine and in animal
feeds has made these resistant bacteria very common. A large percentage of the
bacteria found in a hospital environment will be resistant to many antibiotics,
since those that are susceptible have already been killed.
Plasmids
are important in genetic engineering, so maybe this and other useful purposes
makes up somewhat for the harm they do.
TRANPOSONS
These are small segments of DNA that can move from one region
of a DNA molecule to another. They may move from one site to another on the
same chromosome, or to another chromosome or a plasmid. Transposition is
relatively rare, but it does occur in all organisms.